Keyword Analysis & Research: structure of dna labeled

Keyword Analysis



Keyword Research: People who searched structure of dna labeled also searched

Frequently Asked Questions

What best describes the structures of DNA?

DNA structure DNA is the molecule that holds the instructions for growth and development in every living thing. Its structure is described as a double-stranded helix held together by complementary ...

What are the primary and secondary structures of DNA?

Primary structure: sequence of bases in a strand (e.g., ATTTTCGTAAAGGCGTAAAGGCCTTTGTC….)Secondary structure: Interactions between bases to form more complex structures.DNA's secondary structure tends to be a double helix, while RNA often has intramolecular bondind that forms things like hairpin loops, etc.. Then, what is the primary structure of DNA?

Which statement describes the structure of DNA?

In a circular bacterial chromosome, the structure of DNA is a _1_ double helix. If DNA is twisted in the _2_ direction, it becomes overwound. Overwinding results in _3_ supercoiling. If DNA is twisted in the _4_ direction, it becomes underwound. Underwinding results in _5_ supercoiling.

What is the shape of DNA called?

The shape of DNA (deoxyribonucleic acid) is called a ‘double helix.’ It is a chain of smaller molecules which makes DNA the largest molecule in any organism. Each side of the DNA molecule is a kind of backbone structure made of sugars alternating with phosphates, like the two sides of a ladder.


Search Results related to structure of dna labeled on Search Engine