| Keyword | CPC | PCC | Volume | Score | Length of keyword |
|---|---|---|---|---|---|
| structure of dna labeled | 0.67 | 0.8 | 168 | 37 | 24 |
| structure | 1.71 | 0.5 | 4607 | 97 | 9 |
| of | 1.25 | 0.3 | 6158 | 34 | 2 |
| dna | 0.17 | 0.3 | 7235 | 27 | 3 |
| labeled | 0.6 | 0.9 | 5837 | 23 | 7 |
| Keyword | CPC | PCC | Volume | Score |
|---|---|---|---|---|
| structure of dna labeled | 0.84 | 0.1 | 1731 | 33 |
| structure of dna labelled | 0.7 | 0.9 | 8385 | 39 |
| structure of dna labelled diagram | 1.84 | 1 | 8989 | 100 |
| dna structure diagram labeled | 1.58 | 0.2 | 2949 | 80 |
| dna molecule structure labeled | 0.44 | 0.9 | 3867 | 2 |
| dna double helix structure labeled | 0.66 | 0.6 | 2499 | 51 |
| dna structure model labeled | 1.98 | 0.5 | 6282 | 76 |
DNA structure DNA is the molecule that holds the instructions for growth and development in every living thing. Its structure is described as a double-stranded helix held together by complementary ...
What are the primary and secondary structures of DNA?Primary structure: sequence of bases in a strand (e.g., ATTTTCGTAAAGGCGTAAAGGCCTTTGTC….)Secondary structure: Interactions between bases to form more complex structures.DNA's secondary structure tends to be a double helix, while RNA often has intramolecular bondind that forms things like hairpin loops, etc.. Then, what is the primary structure of DNA?
Which statement describes the structure of DNA?In a circular bacterial chromosome, the structure of DNA is a _1_ double helix. If DNA is twisted in the _2_ direction, it becomes overwound. Overwinding results in _3_ supercoiling. If DNA is twisted in the _4_ direction, it becomes underwound. Underwinding results in _5_ supercoiling.
What is the shape of DNA called?The shape of DNA (deoxyribonucleic acid) is called a ‘double helix.’ It is a chain of smaller molecules which makes DNA the largest molecule in any organism. Each side of the DNA molecule is a kind of backbone structure made of sugars alternating with phosphates, like the two sides of a ladder.
